Filters
Technology
Platform
GSE50002
Mus musculus
15 Downloadable Samples
Affymetrix Mouse Gene 1.0 ST Array (mogene10st)
Description
Twist1 is a transcription factor that induces EMT and drives metastasis in prostate cancer. We examined global gene expression in Myc-CaP mouse prostate cancer cells following overexpression
Publication Title
The twist box domain is required for Twist1-induced prostate cancer metastasis.
Sample Metadata Fields
Cell line
View Samples- Homo sapiens
- 14 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Macrophages in tumor microenvironment have been characterized as M1- and M2-polarized subtypes. This study sought to investigate the effects of different macrophage subtypes on the biological behavior and global gene expression profiles of lung cancer cells. Expression microarray and bioinformatics analyses indicated that the different macrophage subtypes mainly regulated genes involved in cell cycle, cytoskeletal remodeling, coagulation, cell adhesion and apoptosis pathways in A549 cells, a pattern that correlated with the altered behavior of A549 cells observed after coculture with macrophage subtypes.
Publication Title
Opposite Effects of M1 and M2 Macrophage Subtypes on Lung Cancer Progression.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 6 Downloadable Samples
- Affymetrix Human Genome U133A Array (hgu133a)
Description
In order to identify patterns of gene expression associated with biological effects in THP-1 cells induced by F3, we performed a transcriptomic analysis on the THP-1 control and F3-treated THP-1 cells by oligonucleotide microarray
Publication Title
Ganoderma lucidum polysaccharides in human monocytic leukemia cells: from gene expression to network construction.
Sample Metadata Fields
Cell line
View Samples- Mus musculus
- 6 Downloadable Samples
Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 11 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
The CLS1/CAF co-culture maintained the cancer stemness. This cancer stemness was lost when the CAF feeder cells were removed during passaging.
Publication Title
Cancer-associated fibroblasts regulate the plasticity of lung cancer stemness via paracrine signalling.
Sample Metadata Fields
Cell line
View Samples- Mus musculus
- 24 Downloadable Samples
- Affymetrix Mouse Gene 2.0 ST Array (mogene20st)
Description
The mammary gland at early stages of pregnancy undergoes fast cell proliferation, yet the mechanism to ensure its genome integrity is largely unknown. Here we show that pregnancy enhances expression of genes involved in numerous pathways, including most genes encoding replisomes. In mouse mammary glands, replisome genes are positively regulated by estrogen/ERa signaling but negatively regulated by BRCA1. Upon DNA damage, BRCA1 deficiency markedly enhances DNA replication initiation. BRCA1 deficiency also preferably impairs DNA replication checkpoints mediated by ATR and CHK1 but not by WEE1, which inhibits DNA replication initiation through CDC7-MCM2 pathway and enables BRCA1-deficient cells to avoid further genomic instability. Thus, BRCA1 and WEE1 inhibit DNA replication initiation in a parallel manner to ensure genome stability for mammary gland development during pregnancy.
Publication Title
BRCA1 represses DNA replication initiation through antagonizing estrogen signaling and maintains genome stability in parallel with WEE1-MCM2 signaling during pregnancy.
Sample Metadata Fields
No sample metadata fields
View Samples- Drosophila melanogaster
- 3 Downloadable Samples
- Ion Torrent Proton
Description
We report the high-throughput profiling of brain RNA from three Drosophila stains: dBRWD3PX2/+, dBRWD3PX2/PX2 and dBRWD3PX2/PX2, yemGS21861/GS21861. By obtaining over 50 million reads of sequence, WE compared the transcriptomic differences among the brains from these three stains. We found that the expression of 871 genes was significantly different between heterozygous control and homozygous dBRWD3 mutant brains (484 upregulated genes, 387 downregulated genes, p<0.05). Gene ontology (GO) analysis of the 871 genes revealed a broad spectrum of biological processes, ranging from synaptic activity to housekeeping metabolism subjective to dBRWD3 regulation. Among the 387 downregulated genes, the expression of 360 genes (92.8%) was increased in the dBRWD3, yem double mutant brains compared with dBRWD3 mutant. Among the 484 upregulated genes, the expression of 412 genes (85.1%) was decreased in the double mutant brains. These differential genes were evenly distributed on X chromosome and autosomes (149 on X, 178 on 2L, 154 on 2R, 166 on 3L, and 207 on 3R). These analyses indicate that dBRWD3 regulates gene expression in the brain mainly through the HIRA/YEM complex. Overall design: Examination of brain transcriptome in 3 Drosophila strains.
Publication Title
Intellectual disability-associated dBRWD3 regulates gene expression through inhibition of HIRA/YEM-mediated chromatin deposition of histone H3.3.
Sample Metadata Fields
Specimen part, Cell line, Subject
View Samples- Homo sapiens
- 18 Downloadable Samples
- Illumina HumanHT-12 V4.0 expression beadchip
Description
The majority of the human genome is transcribed, yielding a rich repository of non-coding transcripts that are involved in a myriad of biological processes including cancer. However, how non-coding transcripts such as Long Non-coding RNAs (lncRNAs) function in prostate cancer is still unclear. In this study, we have identified a novel set of clinically relevant androgen-regulated lncRNAs in prostate cancer. Among this group, we found LINC00844 is a direct androgen regulated target that is actively transcribed in AR-dependent prostate cancer cells. In clinical analysis, the expression of LINC00844 is higher in normal prostate compared to malignant and metastatic prostate cancer samples and patients with low expression demonstrate poor prognosis and significantly increased biochemical recurrence suggesting LINC00844 may function in suppressing tumor progression and metastasis. From in-vitroloss-of-function studies, we showed LINC00844 prevents prostate cancer cell migration and invasion. Moreover, in gene expression studies we demonstrate LINC00844 functions in trans, affecting global androgen-regulated gene transcription. Mechanistically, we provide evidence to show LINC00844 is important in facilitating AR binding to the chromatin. Finally, we showed LINC00844 mediates its phenotypic effects in part by activating the expression of NDRG1, a crucial cancer metastasis suppressor. Collectively, our findings indicate LINC00844 is a novel coregulator of AR that plays an important role in the androgen transcriptional network and the development and progression of prostate cancer.
Publication Title
Novel lncRNA <i>LINC00844</i> Regulates Prostate Cancer Cell Migration and Invasion through AR Signaling.
Sample Metadata Fields
Cell line, Treatment
View Samples- Homo sapiens
- 7 Downloadable Samples
Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Epstein-Barr virus (EBV) Rta is a latent-lytic molecular switch evolutionarily conserved in all gamma-herpesviruses. In previous studies, doxycycline-inducible Rta was shown to potently produce an irreversible G1 arrest followed by cellular senescence in 293 cells. Here, we demonstrate that in this system the inducible Rta not only reactivates resident genome of EBV but also that of Kaposis sarcoma-associated herpesvirus (KSHV), to similar efficiency. However, Rta-induced senescence program was terminated by the robust viral lytic cycle replication that eventually caused cell death. Furthermore, prior to the abrupt expression of immediate-early protein (EBV BZLF1 or KSHV RTA), Rta simultaneously down-regulates cell cycle activators (c-Myc, CDK6, CCND2) and up-regulates senescence-related genes (p21, 14-3-3s). Since Rta is a viral immediate-early transcriptional activator, it is envisioned that during the initial stage of viral reactivation, Rta may engage to modulate the host transcriptome, to halt cell cycle progression, and to maintain an ideal environment for manufacturing infectious virions.
Publication Title
Epstein-Barr virus (EBV) Rta-mediated EBV and Kaposi's sarcoma-associated herpesvirus lytic reactivations in 293 cells.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 4 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
EBV Rta is a transcriptional activator that functions to disrupt EBV latency in cells of epithelial origin. This series of experiment is to identify host genes that are moduated by the expression of doxycycline-inducible EBV Rta in HEK293 cells. Designations for the pooled EBV Rta inducible cell lines is 293TetER; pooled luciferase inducible lines is 293TetLuc (control).
Publication Title
Epstein-Barr virus (EBV) Rta-mediated EBV and Kaposi's sarcoma-associated herpesvirus lytic reactivations in 293 cells.
Sample Metadata Fields
Specimen part, Cell line
View Samples