Filters
Technology
Platform
GSE80654
Homo sapiens
51 Downloadable Samples
Affymetrix Human Transcriptome Array 2.0 (hta20)
Description
Adipose tissue from 6 non-obese patients was collagenase treated and adipocytes separated from the stromal vascular fraction(SVF). SVF was then FACS sorted for the following fractions CD45-/CD34+/CD31+ (endothelial), CD45-/CD34+/CD31- (progenitor), CD45+/CD14+ (monocyte/macrophage), CD45+/CD14-(Leukocyte). RNA was isolated from adipocyte, SVF, progenitor, macrophage/monocyte and leukocyte fractions and analyzed on the Affymetrix Human Transcriptome 2.0 array. We also sorted SVF from an additional 13 (10 non-obese, 9 obese) patients and sent progenitor RNA for Affymetrix Human Transcriptome 2.0 array analysis.
Publication Title
The cell-type specific transcriptome in human adipose tissue and influence of obesity on adipocyte progenitors.
Sample Metadata Fields
Sex, Specimen part, Subject
View Samples- Homo sapiens
- 9 Downloadable Samples
Illumina HiSeq 2000, Affymetrix Human Gene 1.1 ST Array (hugene11st)
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
Early B cell factor 1 regulates adipocyte morphology and lipolysis in white adipose tissue.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 9 Downloadable Samples
Affymetrix Human Gene 1.1 ST Array (hugene11st), Illumina HiSeq 2000
Description
To investgate the role of EBF1 in human adipocyte, we performed global expression profiling in human adipocytes transfected with siRNA targeting EBF1.
Publication Title
Early B cell factor 1 regulates adipocyte morphology and lipolysis in white adipose tissue.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 4 Downloadable Samples
- Illumina HiSeq 4000
Description
Lgr6-positive cells have been shown to label stem/progenitors cells in several tissues including tongue and skin. However their role in mammary gland has never been investigated. Here we used Lgr6-eGFP-IRES-CreER2 mice to isolate and characterize Lgr6-positive population in mammary gland of 5-week old female mice. Overall design: Examination of transcriptional differences between Lgr6 positive and negative cells
Publication Title
Lgr6 labels a rare population of mammary gland progenitor cells that are able to originate luminal mammary tumours.
Sample Metadata Fields
Sex, Specimen part, Subject
View Samples- Homo sapiens
- 3 Downloadable Samples
- Illumina HiSeq 2500
Description
HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Publication Title
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Sample Metadata Fields
Cell line, Subject
View Samples- Mus musculus
- 107 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Publication Title
Application of a translational profiling approach for the comparative analysis of CNS cell types.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Publication Title
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 72 Downloadable Samples
- Illumina HiSeq 2000
Description
The goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.
Publication Title
Stochastic principles governing alternative splicing of RNA.
Sample Metadata Fields
Subject
View Samples- Mus musculus
- 9 Downloadable Samples
- Affymetrix Murine Genome U74A Version 2 Array (mgu74av2), Affymetrix Murine Genome U74A Array (mgu74a)
Description
Biological comparison of gene expression profiles of adult male whole Muta™Mouse lung with its immortalized 100% confluent epithelial lung cell line counterpart. White, P.A.,et al. 2003. Development and characterization of an epithelial cell line from Muta™Mouse lung. Environ Mol Mutagen 42,3 pgs 166-184
Publication Title
Comprehensive comparison of six microarray technologies.
Sample Metadata Fields
Sex, Specimen part, Cell line, Subject
View Samples