Filters
Technology
Platform
GSE56483
Mus musculus
18 Downloadable Samples
Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Using the novel BTK inhibitor PF-303, we model the clinical phenotype of BTK inhibition by systematically examining the impact of PF-303 on the mature immune system in mice autoimmune indications. However, our current knowledge of the role of BTK in immune competence has been gathered in the context of genetic inactivation of btk in both mice and man. Using the novel BTK inhibitor PF-303, we model the clinical phenotype of BTK inhibition by systematically examining the impact of PF-303 on the mature immune system in mice. We implicate BTK in tonic BCR signaling, demonstrate dependence of the T3 B cell subset and IgM surface expression on BTK activity, and find that B1 cells survive and function independently of BTK. While BTK inhibition does not impact humoral memory survival, antigen-driven clonal expansion of memory B cells and antibody secreting cell generation are inhibited. These data define the role of BTK in the mature immune system and mechanistically predict the clinical phenotype of BTK inhibition.
Publication Title
Modeling the clinical phenotype of BTK inhibition in the mature murine immune system.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 3 Downloadable Samples
Illumina HiSeq 2500
Description
HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Publication Title
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Sample Metadata Fields
Cell line, Subject
View Samples- Homo sapiens
- 14 Downloadable Samples
- IlluminaHiSeq2500
Description
It is fundamentally unknown how normal cellular processes or responses to extracellular stimuli may invoke polyadenylation and degradation of ncRNA substrates or if human disease processes exhibit defects in polyadenylation of ncRNA substrates as part of their pathogenesis. Our results demonstrate that mononuclear cells from subjects with relapsing-remitting multiple sclerosis (RRMS) exhibit pervasive increases in levels of polyadenylated ncRNAs including Y1 RNA, 18S and 28S rRNA, and U1, U2, and U4 snRNAs and these defects are unique to RRMS. Defects in expression of both Ro60 and La proteins in RRMS appear to contribute to increased polyadenylation of ncRNAs. Further, IFN-ß1b, a common RRMS therapy, restores both Ro60 and La levels to normal as well as levels of polyadenylated Y1 RNA and U1 snRNA suggesting that aberrant polyadenylation of ncRNA substrates may have pathogenic consequences. Overall design: We extracted RNA from peripheral whole blood in healthy control subjects and patients with established relapsing-remitting multiple sclerosis using PaxGene tubes.
Publication Title
Defective structural RNA processing in relapsing-remitting multiple sclerosis.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 12 Downloadable Samples
- IlluminaHiSeq2500
Description
To improve our understanding of lncRNA expression in T cells, we used whole genome sequencing (RNA-seq) to identify lncRNAs expressed in human T cells and those selectively expressed in T cells differentiated under TH1, TH2, or TH17 polarizing conditions. The majority of these lineage-specific lncRNAs are co-expressed with lineage-specific protein-coding genes. These lncRNAs are predominantly intragenic with co-expressed protein-coding genes and are transcribed in sense and antisense orientations with approximately equal frequencies. Further, genes encoding TH lineage specific mRNAs are not randomly distributed across the genome but are highly enriched in the genome in genomic regions also containing genes encoding TH lineage-specific lncRNAs. Our analyses also identify a cluster of antisense lncRNAs transcribed from the RAD50 locus that are selectively expressed under TH2 polarizing conditions and co-expressed with IL4, IL5 and IL13 genes. Depletion of these lncRNAs via selective siRNA treatment demonstrates the critical requirement of these lncRNAs for expression of the TH2 cytokines, IL-4, IL-5 and IL-13. Collectively, our analyses identify new lncRNAs expressed in a TH lineage specific manner and identify a critical role for a cluster of lncRNAs for expression of genes encoding TH2 cytokines. Overall design: Human peripheral blood mononuclear cells (PBMC) were cultured under TH1, TH2, and TH17 polarizing conditions. TH1, TH2, and TH17 primary and effector cultures were isolated and poly(A)+ and total RNA sequencing performed.
Publication Title
Expression and functions of long noncoding RNAs during human T helper cell differentiation.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 6 Downloadable Samples
- Affymetrix Mouse Gene 1.0 ST Array (mogene10st)
Description
We used Affymetrix DNA arrays to investigate the extent to which nuclear HDAC4 accumulation affects neuronal gene expression.
Publication Title
HDAC4 governs a transcriptional program essential for synaptic plasticity and memory.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 107 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Publication Title
Application of a translational profiling approach for the comparative analysis of CNS cell types.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 4 Downloadable Samples
- IlluminaGenomeAnalyzerII
Description
The Carboxy-terminal domain (CTD) of RNA Polymerase II (RNAPII) in mammals undergoes extensive post-translational modification, which is essential for transcriptional initiation and elongation. Here, we show that the CTD of RNAPII is methylated at a single arginine (R1810) by the transcriptional co-activator CARM1. Although methylation at R1810 is present on the hyper-phosphorylated form of RNAPII in vivo, Ser-2 or Ser-5 phosphorylation inhibit CARM1 activity towards this site in vitro, suggesting that methylation occurs before transcription initiation. Mutation of R1810 results in the mis-expression of a variety of snRNAs and snoRNAs, an effect that is also observed in Carm1-/- MEFs. These results demonstrate that CTD methylation facilitates the expression of select RNAs, perhaps serving to discriminate the RNAPII-associated machinery recruited to distinct gene types. Overall design: To address the function of RNAPII methylation, we generated Raji cell lines expressing an RNA Polymerase II resistant to a-amanitin and carrying either wild-type R1810 or an arginine to alanine substitution at that same residue, abolishing R1810 methylation of the CTD. In cells cultured in a-amanitin, the a-amanitin-resistant mutants fully replaced the functions of endogenous RNAPII, allowing us to study if gene-expression is affected by the absence of R1810me
Publication Title
The C-terminal domain of RNA polymerase II is modified by site-specific methylation.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Publication Title
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Danio rerio
- 12 Downloadable Samples
- IlluminaHiSeq2000
Description
This study sought to evaluate the effects of dietary MeHg exposure on adult female yellow perch (Perca flavescens) and zebrafish (Danio rerio) reproduction by relating controlled exposures with subsequent reproductive effects. Yellow perch were used in the study for their socioeconomic and ecological importance within the Great Lakes basin, and the use of zebrafish allowed for a detailed analysis of the molecular effects of MeHg. MeHg exposures at environmentally relevant levels were done in zebrafish for a full life cycle, mimicking a realistic exposure scenario, and in adult yellow perch for twenty weeks, capturing early seasonal ovarian development. In zebrafish, several genes involved in reproductive processes were shown to be dysregulated by RNA-seq and QPCR, but no significant phenotypic or physiological changes were observed with ovarian staging, fecundity, or embryo mortality. Yellow perch did not appear to be affected by MeHg, either at a molecular level, as assessed by QPCR of eight genes in the pituitary, liver, and ovary tissue, or a physiological level, as seen with ovarian somatic index, circulating estradiol, and ovarian staging. Lack of impact in yellow perch limits the usefulness of zebrafish as a model and suggests that the reproductive sensitivity to environmentally relevant levels of MeHg differs between yellow perch and zebrafish. Overall design: 12 samples of total RNA isolated from adult zebrafish ovaries were analyzed. Each exposure group (1, 3, and 10 ppm MeHg) had three replicates, as did the vehicle control. Each sample was comprised of pooled total RNA of up to 6 individual fish.
Publication Title
Female reproductive impacts of dietary methylmercury in yellow perch (Perca flavescens) and zebrafish (Danio rerio).
Sample Metadata Fields
No sample metadata fields
View Samples