Filters
Technology
Platform
SRP032775
Homo sapiens
232 Downloadable Samples
IlluminaHiSeq2000
Description
Immunity to malaria can be acquired through natural exposure to Plasmodium falciparum (Pf), but only after years of repeated infections. Typically, this immunity is acquired by adolescence and confers protection against disease, but not Pf infection per se. Efforts to understand the mechanisms of this immunity are integral to the development of a vaccine that would mimic the induction of adult immunity in children. The current study applies transcriptomic analyses to a cohort from the rural village of Kalifabougou, Mali, where Pf transmission is intense and seasonal. Signatures that correlate with protection from malaria may yield new hypotheses regarding the biological mechanisms through which malaria immunity is induced by natural Pf infection. The resulting datasets will be of considerable value in the urgent worldwide effort to develop a malaria vaccine that could prevent more than a million deaths annually. Overall design: 108 samples; paired pre- and post-challenge for 54 individuals 198 samples; paired pre- and post-challenge for 99 individuals
Publication Title
Transcriptomic evidence for modulation of host inflammatory responses during febrile Plasmodium falciparum malaria.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 37 Downloadable Samples
- Illumina HiSeq 2000
Description
The Sanaria® PfSPZ Vaccine can confer sterilizing protection against liver stage infection by Plasmodium falciparum (Pf) in malaria naïve individuals. The vaccine consists of aseptically purified irradiated Pf sporozoites. The PfSPZ Vaccine trial in Mali was the first to evaluate the safety and efficacy of this vaccine in a malaria endemic region. Vaccinees received five doses of 2.7 X 105 irradiated sporozoites and the efficacy was measured against naturally occurring Pf Infections in Malian adults during the malaria transmission season. Overall design: 44 samples from 2 time points, pre-vaccination (Day -7) and post-vaccination (Day 143), for 22 Malian adult participants ( 5 placebo controls and 17 vaccine recipients). 11 of the vaccinated participants remained infection free over the subsequent malaria transmission season.
Publication Title
γδ T Cells Are Required for the Induction of Sterile Immunity during Irradiated Sporozoite Vaccinations.
Sample Metadata Fields
Subject, Time
View Samples- Homo sapiens
- 19 Downloadable Samples
Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Adipose tissues play an important role in the pathophysiology of obesity-related disease including type 2 diabetes. To describe gene expression patterns and functional pathways in obesity-related type 2 diabetes, we performed global transcript profiling of omental adipose tissue in morbidly obese individuals with or without diabetes.
Publication Title
Global Gene Expression Profiling in Omental Adipose Tissue of Morbidly Obese Diabetic African Americans.
Sample Metadata Fields
Sex
View Samples- Homo sapiens
- 3 Downloadable Samples
- Illumina HiSeq 2500
Description
HeLa cells lacking MORC2 generated through CRISPR/Cas9-mediated gene disruption were reconstituted with either wild-type or R252W mutant MORC2, and re-repression of HUSH target genes assessed by RNA-seq Overall design: Total RNA-seq of MORC2 knockout cells, either 1) mock transduced, 2) transduced with lentiviral vector encoding wild-type MORC2 or 3) transduced with lentviral vector encoding R252W MORC2.
Publication Title
Hyperactivation of HUSH complex function by Charcot-Marie-Tooth disease mutation in MORC2.
Sample Metadata Fields
Cell line, Subject
View Samples- Mus musculus
- 107 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Comparative analysis can provide important insights into complex biological systems. As demonstrated in the accompanying paper, Translating Ribosome Affinity Purification (TRAP), permits comprehensive studies of translated mRNAs in genetically defined cell populations following physiological perturbations.
Publication Title
Application of a translational profiling approach for the comparative analysis of CNS cell types.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 20 Downloadable Samples
- Affymetrix Mouse Gene 2.0 ST Array (mogene20st)
Description
Tristetraprolin (TTP, encoded by Zfp36) regulates the mRNA stability of several important cytokines. Due to the critical role of this RNA-binding protein in the control of inflammation, TTP deficiency leads to the spontaneous development of a complex inflammatory syndrome. So far, this phenotype has been largely attributed to dysregulated production of TNF and IL-23 by myeloid cells such as macrophages or dendritic cells. Here, we generated mice with conditional deletion of TTP in keratinocytes. These mice developed exacerbated inflammation in the imiquimod-induced psoriasis model. Furthermore, these mice progressively developed a spontaneous pathology with systemic inflammation, psoriatic-like skin lesions and dactylitis. Finally, we provide evidence that keratinocyte-derived TNF productin drives the different pathological features. In summary, these findings expand current views on the initiation of psoriasis and related arthritis by revealing the keratinocyte-intrinsic role of TTP.
Publication Title
Tristetraprolin expression by keratinocytes controls local and systemic inflammation.
Sample Metadata Fields
Specimen part, Treatment
View Samples- Arabidopsis thaliana
- 24 Downloadable Samples
- Affymetrix Arabidopsis ATH1 Genome Array (ath1121501)
Description
The effects of phosphate starvation in Arabidopsis thaliana (L.) plants were compared in plants grown in liquid MS medium transferred in low or high Pi and in plants grown vertically in petri dishes during 10 days. In the transfer experiments, 2 treatments were analysed for evaluating the short-(3, 6 and 12 h pooled) and medium-(1 and 2 d pooled) term effects of Pi deficiency on the gene expression. Since some Arabidopsis genes are regulated by diurnal rhythm and circadian clocks, plantlets were harvested separately at the beginning and at the end of the photoperiod and pooled. In the long term experiment, leaves and roots were sampled separately after 10 days. Triplicates were analysed for each experiment.
Publication Title
A genome-wide transcriptional analysis using Arabidopsis thaliana Affymetrix gene chips determined plant responses to phosphate deprivation.
Sample Metadata Fields
Specimen part, Subject
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We developed a mouse line targeting midbrain dopamine neurons for Translating Ribosome Affinity Purification (TRAP). Here, we briefly report on the basic characterization of this mouse line including confirmation of expression of the transgene in midbrain dopamine neurons and validation of its effectiveness in capturing mRNA from these cells. We also report a translational profile of these neurons which may be of use to investigators studying the gene expression of these cells. Finally, we have donated the line to Jackson Laboratories for distribution and use in future studies.
Publication Title
Generation and characterization of a mouse line for monitoring translation in dopaminergic neurons.
Sample Metadata Fields
Sex, Specimen part
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 72 Downloadable Samples
- Illumina HiSeq 2000
Description
The goal of the study was to analyze the principles governing the usage of alternatively spliced transcript isoform of four types of T-cells (Naïve, Central Memory, Transitional Memory and Effector Memory) between resting and activated status. However, the principles discovered in the T cells were universal and can also be applied to other cell type and tissues. Overall design: Four types of T cells were sorted and whole transcriptome analysis was performed using an Illumina machine The readme.txt contains the column headers and description for the processed data files.
Publication Title
Stochastic principles governing alternative splicing of RNA.
Sample Metadata Fields
Subject
View Samples