Filters
Technology
Platform
SRP067568
Homo sapiens
10 Downloadable Samples
IlluminaHiSeq2500
Description
We used NEBNext Ultra Directional RNA Library Prep Kits to prepare RNA-seq libraries of total RNA from hnRNP A2/B1 and A1 depleted A549 cells. Pro-seq libraries were prepared from A549 cells using Illumina adapters Overall design: hnRNP A2/B1 and A1 depleted A549 cells were generated by lentiviral infections of shRNA constructs. RNAs were isolated using Trizol.
Publication Title
A widespread sequence-specific mRNA decay pathway mediated by hnRNPs A1 and A2/B1.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 8 Downloadable Samples
Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We use mice containing a gene trap in the first intron of the Rest gene, which effectively eliminates transcription from all coding exons, to prematurely remove REST from neural progenitors. We find catastrophic DNA damage that occurs during S-phase of the cell cycle and concominant with activation of p53 pro-apoptotic sgnalling, with consequences including abnormal chromosome separation, apoptosis, and smaller brains.
Publication Title
The REST remodeling complex protects genomic integrity during embryonic neurogenesis.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 8 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Characteristic extinguishing of B-cell phenotype in cHL is believed to be a result of transcription factor network deregulation due to the overexpression of repressor proteins ID2 and ABF-1. KLF4 is a versatile transcription factor, participating in regulation of differentiation processes in various tissues. Epigenetic silencing of KLF4 in cHL hints that KLF4 is involved in the complex mechanism of extinguishing of B-cell phenotype in cHL.
Publication Title
KLF4 is a tumor suppressor in B-cell non-Hodgkin lymphoma and in classic Hodgkin lymphoma.
Sample Metadata Fields
Specimen part, Cell line, Treatment
View Samples- Mus musculus
- 6 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
We use mice containing a gene trap in the first intron of the Rest gene, which effectively eliminates transcription from all coding exons, to prematurely remove REST from neural progenitors. We find catastrophic DNA damage that occurs during S-phase of the cell cycle, with consequences including abnormal chromosome separation, apoptosis, and smaller brains. Further support for persistent effects is the latent appearance of proneural glioblastomas in adult mice also lacking the tumor suppressor, p53. A Rest deficient mouse line generated previously, using a conventional gene targeting approach, does not exhibit these phenotypes, likely due to a remaining C terminal peptide that still binds chromatin and recruits REST chromatin modifiers.Our results indicate that REST-mediated chromatin remodeling is required for proper S-phase dynamics, prior to its well-established role in relieving repression of neuronal genes at terminal differentiation.
Publication Title
The REST remodeling complex protects genomic integrity during embryonic neurogenesis.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 26 Downloadable Samples
- Affymetrix Mouse Gene 1.0 ST Array (mogene10st)
Description
Cytokine signaling is transmitted by cell surface receptors which function as natural biological switches to control among others mainly immune related processes. Recently, we have designed synthetic cytokine receptors (SyCyRs) consisting of GFP- and mCherry-nanobodies fused to trans-membrane and intracellular domains of cytokine receptors, which phenocopied cytokine signaling induced by non-physiological homo- and heterodimeric GFP-mCherry ligands. Interleukin 22 signals via IL-22Rα1 and the common IL-10R2, belongs to the IL-10 cytokine family and is critically involved in tissue regeneration. IL-22 SyCyRs phenocopied native IL-22 signal transduction as shown by induction of cytokine-dependent cellular proliferation, signal transduction and transcriptome analysis. Whereas homodimeric IL-22Rα1 SyCyRs failed to activate signaling, homodimerization of the second IL-22 signaling chain, SyCyR(IL-10R2), which was considered to not induce signal transduction, lead to induction of signal transduction. Interestingly, the SyCyR(IL-10R2) and SyCyR(IL-22Rα1) were able to form functional heterodimeric receptor signaling complexes with the synthetic IL-6 receptor chain SyCyR(gp130). In summary, we demonstrated that IL-22 signaling can be phenocopied by synthetic cytokine receptors. Further we identified a novel IL-10R2 homodimeric receptor complex and receptor cross-talk with gp130.
Publication Title
Synthetic interleukin 22 (IL-22) signaling reveals biological activity of homodimeric IL-10 receptor 2 and functional cross-talk with the IL-6 receptor gp130.
Sample Metadata Fields
Specimen part, Treatment
View Samples- Homo sapiens
- 28 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Large cell lymphomas of the gastrointestinal tract are currently regarded as diffuse large B-cell lymphomas despite a more favourable clinical outcome and a lower aggressiveness compared to other nodal and extranodal DLBCL. We compared gene expression profiles of 28 gastrointestinal marginal zone B-cell lymphomas and variants with several other B-cell lymphoma entities such as Burkitts lymphoma, nodal DLBCL, follicular lymphoma, mantle cell lymphoma, primary mediastinal B-cell lymphoma and normal B-cell populations. Based on a subset of NF-kappaB target genes, partitioning and hierarchical cluster algorithms were used which led to comparable results. The different B-cell subsets, the Burkitts lymphoma, and the small cell lymphomas formed distinct groups, respectively. The DLBCL were subdivided into one group containing only DLBCL samples, one subset clustered together with the PMBL samples, and another one together with the blastic variants of MZBL. These results implicate that extranodal blastic MZBL represent a distinct subgroup of DLBCL.
Publication Title
Comparative gene-expression profiling of the large cell variant of gastrointestinal marginal-zone B-cell lymphoma.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
We used microarrays to detail the global programme of gene expression underlying cardiac development by HDAC2 and identified distinct classes of up-regulated and down-regulated genes during this process.
Publication Title
Hdac2 regulates the cardiac hypertrophic response by modulating Gsk3 beta activity.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 17 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Alternative mRNA splicing provides transcript diversity and has been proposed to contribute to several human diseases. Here, we demonstrate that expression of genes regulating RNA processing is decreased in both liver and skeletal muscle of obese humans. To determine the metabolic impact of reduced splicing factor expression, we further evaluated the splicing factor, SFRS10, identified as down-regulated in obese human liver and skeletal muscle and in high fat fed rodents. siRNA-mediated reductions in SFRS10 expression induced lipogenesis and lipid accumulation in cultured hepatocytes. Moreover, SFRS10 heterozygous mice have both increased hepatic lipogenic gene expression and hypertriglyceridemia. We also demonstrate that LPIN1, a key regulator of lipid metabolism, is a splicing target of SFRS10, with reduced SFRS10 levels favoring the lipogenic isoform of LPIN1. Importantly, LPIN1-specific siRNA abolished the lipogenic effects of decreased SFRS10 expression. Together, our results indicate reduced expression of SFRS10 alters LPIN1 splicing and induces lipogenesis, demonstrating that reduced splicing factor expression observed in human tissues may contribute to metabolic phenotypes associated with human obesity.
Publication Title
Expression of the splicing factor gene SFRS10 is reduced in human obesity and contributes to enhanced lipogenesis.
Sample Metadata Fields
Age, Subject
View Samples- Mus musculus
- 60 Downloadable Samples
- Affymetrix Mouse Expression 430A Array (moe430a)
Description
Coordinated regulation of gene expression levels across a series of experimental conditions provides valuable information about the functions of correlated transcripts. To map gene regulatory pathways, we used microarray-derived gene expression measurements in 60 individuals of an F2 sample segregating for diabetes. We performed correlation analysis among ~40,000 expression traits. By combining correlation among expression traits and linkage mapping information, we were able to identify regulatory networks, make functional predictions to uncharacterized genes, and characterize novel members of known pathways. Using 36 seed traits, we found evidence of coordinate regulation of 160 G-protein coupled receptor (GPCR) pathway expression traits. Of the 160 traits, 50 had their major LOD peak within 8 cM of a locus on chromosome 2, and 81 others had a secondary peak in this region. A previously uncharacterized Riken cDNA clone, which showed strong correlation with stearoyl CoA desaturase 1 expression, was experimentally validated to be responsive to conditions that regulate lipid metabolism. Using linkage mapping, we identified multiple genes whose expression is under the control of transcription regulatory loci. Trait-correlation combined with linkage mapping can reveal regulatory networks that would otherwise be missed if we only studied mRNA traits with statistically significant linkages in this small cross. The combined analysis is more sensitive compared with linkage mapping only.
Publication Title
Combined expression trait correlations and expression quantitative trait locus mapping.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 18 Downloadable Samples
- IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples