Filters
Technology
Platform
Mus musculus
60 Downloadable Samples
Affymetrix Mouse Expression 430A Array (moe430a)
Description
Coordinated regulation of gene expression levels across a series of experimental conditions provides valuable information about the functions of correlated transcripts. To map gene regulatory pathways, we used microarray-derived gene expression measurements in 60 individuals of an F2 sample segregating for diabetes. We performed correlation analysis among ~40,000 expression traits. By combining correlation among expression traits and linkage mapping information, we were able to identify regulatory networks, make functional predictions to uncharacterized genes, and characterize novel members of known pathways. Using 36 seed traits, we found evidence of coordinate regulation of 160 G-protein coupled receptor (GPCR) pathway expression traits. Of the 160 traits, 50 had their major LOD peak within 8 cM of a locus on chromosome 2, and 81 others had a secondary peak in this region. A previously uncharacterized Riken cDNA clone, which showed strong correlation with stearoyl CoA desaturase 1 expression, was experimentally validated to be responsive to conditions that regulate lipid metabolism. Using linkage mapping, we identified multiple genes whose expression is under the control of transcription regulatory loci. Trait-correlation combined with linkage mapping can reveal regulatory networks that would otherwise be missed if we only studied mRNA traits with statistically significant linkages in this small cross. The combined analysis is more sensitive compared with linkage mapping only.
Publication Title
Combined expression trait correlations and expression quantitative trait locus mapping.
Sample Metadata Fields
No sample metadata fields
View Samples- Mus musculus
- 9 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Conjugated linoleic acid (CLA), a class of fatty acids found in beef and dairy products, has been shown to inhibit tumorigenesis in a variety of cancer model systems. Based on previously well-documented anti-tumor activity of CLA in rodent models of breast cancer, a pilot study was initiated to examine the effect of dietary CLA in a well-established transgenic model of breast cancer. Western blots were performed for the detection of AKT, c-Src, ERK1/2, and Cdc24. CLA significantly increased tumor burden (p<0.1) independent of an increase in oncogenic signaling. Mammary gland whole mounts indicated a loss of mammary adipose and extensive epithelial expansion in CLA-treated animals. Microarray analysis indicated a significant reduction in cytoskeletal related genes with at least a two-fold decrease in five out of six CLA-fed animals compared to untreated controls. Reduction of Cdc42, a key regulator of cell adhesion and cytoskeletal arrangements, was confirmed at the protein level by western blot (p<0.01). These findings suggest that dietary CLA may advance the malignant phenotype by promoting a loss of cell polarity and adhesion in the mammary gland epithelium. This action may have serious clinical implications for a subset high-risk population and warrants further investigation.
Publication Title
Pilot study on the effects of dietary conjugated linoleic acid on tumorigenesis and gene expression in PyMT transgenic mice.
Sample Metadata Fields
Sex, Age, Specimen part
View Samples- Mus musculus
- 20 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
Stearoyl-CoA desaturase 1-deficient (SCD1-/-) mice have impaired monounsaturated fatty acid (MUFA) synthesis. When maintained on a very low-fat, high-carbohydrate (VLF-HC) diet, SCD1-/- mice develop severe hypercholesterolemia characterized by an increase in apolipoprotein B-containing lipoproteins and the appearance of lipoprotein-X. Additionally, high-density lipoprotein cholesterol is dramatically reduced in VLF-HC SCD1-/- mice. The concomitant presence of elevated plasma bile acids, bilirubin and aminotransferases in the VLF-HC SCD1-/- mouse are indicative of hepatic dysfunction. Supplementation of the VLF-HC diet with unsaturated fat (canola oil), but not saturated fat (coconut oil), prevents these plasma phenotypes. However, dietary oleate was not as effective as canola oil in reducing low-density lipoprotein cholesterol, signifying an additional role for dietary polyunsaturated fatty acid deficiency in the development of this phenotype. These results indicate that lack of SCD1 results in an increased requirement for dietary unsaturated fat to compensate for impaired MUFA synthesis and to prevent hypercholesterolemia and hepatic dysfunction.
Publication Title
Cholestasis and hypercholesterolemia in SCD1-deficient mice fed a low-fat, high-carbohydrate diet.
Sample Metadata Fields
No sample metadata fields
View Samples
GSE43606- Homo sapiens
- 9 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Diffuse large B-cell lymphoma (DLBCL) is the most common form of lymphoma in adults. The disease exhibits a striking heterogeneity in gene expression profiles and clinical outcomes, but its genetic causes remain to be fully defined. Through whole genome and exome sequencing, we characterized the genetic diversity of DLBCL. In all, we sequenced 73 DLBCL primary tumors (34 with matched normal DNA). Separately, we sequenced the exomes of 21 DLBCL cell lines. We identified 322 DLBCL cancer genes that were recurrently mutated in primary DLBCLs. We identified recurrent mutations implicating a number of known and not previously identified genes and pathways in DLBCL including those related to chromatin modification (ARID1A and MEF2B), NF-B (CARD11 and TNFAIP3), PI3 kinase (PIK3CD, PIK3R1, and MTOR), B-cell lineage (IRF8, POU2F2, and GNA13), and WNT signaling (WIF1). We also experimentally validated a mutation in PIK3CD, a gene not previously implicated in lymphomas. The patterns of mutation demonstrated a classic long tail distribution with substantial variation of mutated genes from patient to patient and also between published studies. Thus, our study reveals the tremendous genetic heterogeneity that underlies lymphomas and highlights the need for personalized medicine approaches to treating these patients.
Publication Title
Genetic heterogeneity of diffuse large B-cell lymphoma.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 26 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 17 Downloadable Samples
- Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Burkitt lymphoma is characterized by deregulation of MYC, but the contribution of other genetic mutations to the disease is largely unknown. Here, we describe the first completely sequenced genome from a Burkitt lymphoma tumor and germline DNA from the same affected individual. We further sequenced the exomes of 59 Burkitt lymphoma tumors and compared them to sequenced exomes from 94 diffuse large B-cell lymphoma (DLBCL) tumors. We identified 70 genes that were recurrently mutated in Burkitt lymphomas, including ID3, GNA13, RET, PIK3R1 and the SWI/SNF genes ARID1A and SMARCA4. Our data implicate a number of genes in cancer for the first time, including CCT6B, SALL3, FTCD and PC. ID3 mutations occurred in 34% of Burkitt lymphomas and not in DLBCLs. We show experimentally that ID3 mutations promote cell cycle progression and proliferation. Our work thus elucidates commonly occurring gene-coding mutations in Burkitt lymphoma and implicates ID3 as a new tumor suppressor gene.
Publication Title
Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 18 Downloadable Samples
IlluminaHiSeq2500
Description
Eukaryotic genes generate multiple mRNA transcript isoforms though alternative transcription, splicing, and polyadenylation. However, the relationship between human transcript diversity and protein production is complex as each isoform can be translated differently. We fractionated a polysome profile and reconstructed transcript isoforms from each fraction, which we term Transcript Isoforms in Polysomes sequencing (TrIP-seq). Analysis of these data revealed regulatory features that control ribosome occupancy and translational output of each transcript isoform. We extracted a panel of 5' and 3' untranslated regions that control protein production from an unrelated gene in cells over a 100-fold range. Select 5' untranslated regions exert robust translational control between cell lines, while 3' untranslated regions can confer cell-type-specific expression. These results expose the large dynamic range of transcript-isoform-specific translational control, identify isoform-specific sequences that control protein output in human cells, and demonstrate that transcript isoform diversity must be considered when relating RNA and protein levels. Overall design: Total cytoplasmic and eight polysomal fractions of RNA were purified from HEK 293T cells in biological duplicate. Ribosomal RNA was depleted using Ribo-Zero (Human/Mouse/Rat; Epicenter) and libraries were prepared using the TruSeq RNA v2 kit (RS-122-2001; Illumina) skipping the polyA selection step. Reads are paired-end 75bp and sequencing adapters are GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (read1) and AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT (read2).
Publication Title
Tunable protein synthesis by transcript isoforms in human cells.
Sample Metadata Fields
No sample metadata fields
View Samples- Saccharomyces cerevisiae
- 6 Downloadable Samples
- Affymetrix Yeast Genome 2.0 Array (yeast2)
Description
Altered mRNA levels of HBT1 were observed in S. cerevisiae cells expressing hsc82-W296A compared to WT HSC82. We conducted microarray analysis to determine the extent of other changes in that strain.
Publication Title
Identification of an Hsp90 mutation that selectively disrupts cAMP/PKA signaling in Saccharomyces cerevisiae.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 17 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Previous studies have reported that human pluripotent stem cells (hPSCs) generate dorsal forebrain, cortical-like neurons under default differentiation in the absence of patterning morphogens. Novel bioinformatic analyses of whole transcriptome data allow us to examine these cells' regional specification more comprehensively. Furthermore, these tools allow us to ask how well hPSNs mimic their endogenous counterparts during various stages of in vivo human brain development.
Publication Title
Default Patterning Produces Pan-cortical Glutamatergic and CGE/LGE-like GABAergic Neurons from Human Pluripotent Stem Cells.
Sample Metadata Fields
Sex, Specimen part, Time
View Samples- Ovis aries
- 4 Downloadable Samples
- Affymetrix Bovine Genome Array (bovine)
Description
Reverse genetics has been widely used to investigate function of viral genes. In the present study we investigated the gene expression profile of a primary ovine cell (OFTu) in response to infection with the wild type (OV-IA82) and deletion mutant virus (OV-IA82024) aiming to determine possible functions for ORFV024 during ORFV infection.
Publication Title
A novel inhibitor of the NF-{kappa}B signaling pathway encoded by the parapoxvirus orf virus.
Sample Metadata Fields
Specimen part
View Samples