Filters
Technology
Platform
SRP074231
Mus musculus
6 Downloadable Samples
Illumina HiSeq 2500
Description
Purpose: Homeostatic control of vascular smooth muscle cell (VSMC) differentiation is critical for contractile activity and regulation of blood flow. Recently, we reported that pre-contracted blood vessels are relaxed and the phenotype of VSMC is regulated from a synthetic to contractile state by glucose-6-phosphate dehydrogenase (G6PD) inhibition. In the current study, we investigated whether the increase in the expression of VSMC contractile proteins by inhibition and knockdown of G6PD is mediated through a protein kinase G (PKG)-dependent pathway and whether it regulates blood pressure Methods: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500. The sequence reads that passed quality filters (Trimmomatic-0.32) were analyzed at the transcript isoform level using STAR_2.4.2a for mapping to reference GRCm38.p4 + Gencode-M6 Annotation and processed with Cufflinks-2.0.2. miR analysis was performed by quantitative RT-PCR (qRT-PCR) for validation using miR-specific TaqMan miR assays (Applied Biosystems, Foster City, CA). Quantitative PCR was performed in triplicate using TaqMan Universal PCR Master mix. Standard curves were made for each miR using synthetic miR oligonucleotides (IDT, Coralville, IA) with the following sequence: Rno-miR-145: GUCCAGUUUUCCCAGGAAUCCCU, Rno-miR-1: UGGAAUGUAAAGAAGUGUGUAU, Rno-miR-143: UGAGAUGAAGCACUGUAGCUC, Rno-miR-133a: UUUGGUCCCCUUCAACCAGCUG Results: We found that the expression of VSMC-restricted contractile proteins, myocardin (MYOCD), and miR-1 and miR-143 are increased by G6PD inhibition or knockdown. Importantly, RNA-sequence analysis of aortic tissue from G6PD-deficient mice revealed uniform increases in VSMC-restricted genes, particularly those regulated by the MYOCD-serum response factor (SRF) switch. Conversely, expression of Krüppel-like factor 4 (KLF4) is decreased by G6PD inhibition. Interestingly, the G6PD inhibition-induced expression of miR-1 and contractile proteins was blocked by Rp-ß-phenyl-1,N2-etheno-8-bromo-guanosine-3’,5’-cyclic monophosphorothioate, a PKG inhibitor. On the other hand, MYOCD and miR-143 levels are increased by G6PD inhibition through a PKG-independent manner. Furthermore, blood pressure was lower in the G6PD-deficient as compared to wild-type mice Conclusions: Therefore, our results suggest that the expression of VSMC contractile proteins induced by G6PD inhibition occurs via PKG1?-dependent and –independent pathways Overall design: Coronary arteries (LAD) isolated from bovine heart mRNA profiles of 12-16 week old wild type (WT) and G6PD-deficient mice were generated by deep sequencing, in triplicate, using Illumina HiSeq 2500 genotype/variation: CYPKO: Sample 1,Sample 2,Sample 3 genotype/variation: G6PD: Sample 4,Sample 5,Sample 6 biological replicate: Sample 1,Sample 2,Sample 3 biological replicate: Sample 4,Sample 5,Sample 6
Publication Title
Vascular smooth muscle cell contractile protein expression is increased through protein kinase G-dependent and -independent pathways by glucose-6-phosphate dehydrogenase inhibition and deficiency.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 9 Downloadable Samples
Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Understanding gene expression profile and transcriptional regulation of healthy adult human hepatocytes
Publication Title
Differentiation in stem/progenitor cells along fetal or adult hepatic stages requires transcriptional regulators independently of oscillations in microRNA expression.
Sample Metadata Fields
Specimen part, Time
View Samples- Mus musculus
- 48 Downloadable Samples
- Illumina HiSeq 2000
Description
Adenosine-to-Inosine (A-to-I) editing of dsRNA by ADAR proteins is a pervasive feature of the epitranscriptome. There are estimated to be over 100 million potential A-to-I editing sites in humans and A-to-I editing can have varying consequences for gene expression. Whilst editing resulting in protein recoding defines the role of ADAR2, ADAR1 has been proposed to have both editing-dependent and -independent functions. The relative contribution of these putative functions to ADAR1 biology is unclear. We demonstrate that the absence of ADAR1-mediated editing is well tolerated when the cytosolic dsRNA sensor MDA5 is deleted. These mice have normal hematopoiesis, tissue patterning and life span. A direct comparison of the complete deletion of ADAR1 and the specific loss of A-to-I editing activity demonstrates that RNA editing is the only essential function of ADAR1 in adult mice. Therefore, preventing MDA5 substrate formation by endogenous RNA is the essential in vivo function of ADAR1-mediated editing. Overall design: Microfluidics-based multiplex PCR and deep sequencing (mmPCR-seq) identification of A-to-I editing sites in 8 tissues from 12 week old mice in a E861A point mutant of ADAR on a MDA5 knockout background
Publication Title
Protein recoding by ADAR1-mediated RNA editing is not essential for normal development and homeostasis.
Sample Metadata Fields
Sex, Age, Specimen part, Cell line, Subject
View Samples- Mus musculus
- 6 Downloadable Samples
- NextSeq 500
Description
Adenosine-to-Inosine (A-to-I) editing of dsRNA by ADAR proteins is a pervasive feature of the epitranscriptome. There are estimated to be over 100 million potential A-to-I editing sites in humans and A-to-I editing can have varying consequences for gene expression. Whilst editing resulting in protein recoding defines the role of ADAR2, ADAR1 has been proposed to have both editing-dependent and -independent functions. The relative contribution of these putative functions to ADAR1 biology is unclear. We demonstrate that the absence of ADAR1-mediated editing is well tolerated when the cytosolic dsRNA sensor MDA5 is deleted. These mice have normal hematopoiesis, tissue patterning and life span. A direct comparison of the complete deletion of ADAR1 and the specific loss of A-to-I editing activity demonstrates that RNA editing is the only essential function of ADAR1 in adult mice. Therefore, preventing MDA5 substrate formation by endogenous RNA is the essential in vivo function of ADAR1-mediated editing. Overall design: RNAseq of Feotal Brain in a E861A point mutant of ADAR on a MDA5 knockout background generated by deep sequencing, in triplicate using Illumina NextSeq500
Publication Title
Protein recoding by ADAR1-mediated RNA editing is not essential for normal development and homeostasis.
Sample Metadata Fields
Sex, Age, Specimen part, Cell line, Subject
View Samples- Homo sapiens
- 21 Downloadable Samples
- Affymetrix HT Human Genome U133A Array (hthgu133a)
Description
Microarrays were used to determine relative global gene expression changes upon introduction of EMT-inducing or control vectors.
Publication Title
Core epithelial-to-mesenchymal transition interactome gene-expression signature is associated with claudin-low and metaplastic breast cancer subtypes.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus
- 9 Downloadable Samples
- Affymetrix Mouse Gene 1.0 ST Array (mogene10st)
Description
Purpose: We have used microarrays to identify gene expression profiles that distinguish mouse OS cells from normal pre-osteoblast cells and mature osteoblast cells.
Publication Title
Wnt inhibitory factor 1 (WIF1) is a marker of osteoblastic differentiation stage and is not silenced by DNA methylation in osteosarcoma.
Sample Metadata Fields
Sex, Cell line
View Samples- Arabidopsis thaliana
- 22 Downloadable Samples
- Arabidopsis Gene 1.0 ST Array (aragene10st)
Description
With frequent fluctuations in global climate, plants often experience co-occurring dry-wet cycles and pathogen infection and this combination adversely affects plant survival. In the past, some studies indicated that morpho-physiological responses of plants to the combined stress are different from the individual stressed plants. However, interaction of drought stressed or drought recovered plants with pathogen has not been widely studied at molecular level. Such studies are important to understand the defense pathways that operate as part of combined stress tolerance mechanism. In this study, Arabidopsis plants were exposed to individual drought stress (soil drying at 40% FC, D), Pseudomonas syringae pv tomato DC3000 (PStDC3000), infection and their combination. Plants recovered from drought stress were also exposed to PStDC3000. Beside we have also infiltrated P. syringae pv tabaci (PSta, non-host pathogen) individually or in combination with drought stress. Using Affymetrix WT gene 1.0 ST array, global transcriptome profiling of plants leaves under individual drought stress and pathogen infection was compared with their combination. Results implicate that plants exposed to combined drought and pathogen stress experience a new state of stress where each combination of stressor and their timing defines the plant responses and thus should be studied explicitly.
Publication Title
Global Transcriptional Analysis Reveals Unique and Shared Responses in Arabidopsis thaliana Exposed to Combined Drought and Pathogen Stress.
Sample Metadata Fields
Specimen part
View Samples- Escherichia coli k-12
- 6 Downloadable Samples
- Affymetrix E. coli Genome 2.0 Array (ecoli2)
Description
The most important approach to the development of platform organisms for recombinant protein production relies on random mutagenesis and phenotypic selection. Complex phenotypes, including those associated with significant elevated expression and secretion of heterologous proteins, are the result of multiple genomic mutations. Using next generation sequencing, a parent and derivative hypersecreter strain (B41) of Escherichia coli were sequenced with an average coverage of 52.8X and 55X, respectively. A new base-pair calling program, revealed a single nucleotide polymorphism in the B41 genome at position 1,074,787, resulting in translation termination near the N-terminus of a transcriptional regulator protein, RutR, coded by the ycdC gene. We verified the hypersecretion phenotype in a ycdC::Tn5 mutant and observed a 3.4-fold increase in active hemolysin secretion, consistent with the increase observed in B41. mRNA expression profiling showed decreased expression of tRNA-synthetases and some amino acid transporters in the ycdC::Tn5 mutant. This study demonstrates that power of next generation sequencing to characterize mutants leading to successful metabolic engineering strategies for strain improvement.
Publication Title
A single nucleotide polymorphism in ycdC alters tRNA synthetase expression and results in hypersecretion in Escherichia coli.
Sample Metadata Fields
No sample metadata fields
View Samples- Caenorhabditis elegans
- 4 Downloadable Samples
- Illumina HiSeq 2000
Description
Purpose: The goal of this study is to identify differentially expressed genes in pry-1/Axin mutant compare to N2 wild-type (WT). Our study represents the first analysis of Axin transcriptome in C. elegans and facilitates investigations of axin mediated processes. Overall design: Whole animal total RNA was extracted from L1 synchronized worms and mRNA profiles of WT and pry-1(mu38) animals were generated by paired end deep sequencing, using Illumina HISeq 2000. The sequence reads that passed quality filters were analyzed using ce6 with Burrows–Wheeler Aligner (BWA) followed by eXpress to estimate transcript abundances. Differentially-expressed genes were called at a false discovery rate (FDR) of 0.05% using the DESeq package in R.
Publication Title
PRY-1/Axin signaling regulates lipid metabolism in Caenorhabditis elegans.
Sample Metadata Fields
Cell line, Subject
View Samples- Homo sapiens
- 29 Downloadable Samples
- Affymetrix Human Exon 1.0 ST Array [transcript (gene) version (huex10st)
Description
Gene expression studies are used to help identify disease-associated genes, by comparing the levels of expressed transcripts between cases and controls, and to identify functional genetic variants known as expression quantitative loci (eQTLs). While many of these studies are performed in blood or lymphoblastoid cell lines due to tissue accessibility, the relevance of expression differences in tissues that are not the primary site of disease is unclear. Further, many eQTLs are tissue specific. Thus, there is a clear and compelling need to conduct gene expression studies in tissues that are specifically relevant to the disease of interest. One major technical concern about using autopsy-derived tissue is how representative it is of physiologic conditions, given the effect of postmortem interval on tissue degradation.
Publication Title
Postmortem cardiac tissue maintains gene expression profile even after late harvesting.
Sample Metadata Fields
Specimen part, Disease, Cell line
View Samples