Filters
Technology
Platform
GSE26629
Homo sapiens
6 Downloadable Samples
Affymetrix Human Gene 1.0 ST Array (hugene10st)
Description
Induced pluripotent stem cell (iPSC) technology has the potential to address the inaccessibility of the human brain by providing investigators with patient-specific neurons that can potentially be used to carry out molecular, electrophysiological and pharmacological studies {{855 Takahashi,K. 2006}}. Although iPSC technology was primarily conceived and developed as a means to bypass the use of human embryonic stem cells (hESCs) for regenerative medicine, its potential for disease modeling may prove to be equally valuable, especially for neuropsychiatric disorders.
Publication Title
Development of patient-specific neurons in schizophrenia using induced pluripotent stem cells.
Sample Metadata Fields
Sex, Age, Specimen part, Time
View Samples- Mus musculus
- 22 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
DNA methyltransferase 3A (DNMT3A) is frequently mutated in hematological cancers; however, the underlying oncogenic mechanism remains elusive. Here, we report that DNMT3A mutational hotspot at Arg882 (DNMT3A R882H) cooperates with NRAS mutation to transform hematopoietic stem/progenitor cells and induce acute leukemia development. Mechanistically, DNMT3A R882H directly binds to and potentiates transactivation of stemness genes critical for leukemogenicity including Meis1, Mn1 and Hoxa gene cluster. DNMT3A R882H induces focal epigenetic alterations, including CpG hypomethylation and concurrent gain of active histone modifications, at cis-regulatory elements such as enhancers to facilitate gene transcription. CRISPR/Cas9-mediated ablation of a putative Meis1 enhancer carrying DNMT3A R882H-induced DNA hypomethylation impairs Meis1 expression. Importantly, DNMT3A R882H-induced gene expression programs can be repressed through Dot1l inhibition, providing an attractive therapeutic strategy for DNMT3A-mutated leukemias.
Publication Title
Epigenetic Perturbations by Arg882-Mutated DNMT3A Potentiate Aberrant Stem Cell Gene-Expression Program and Acute Leukemia Development.
Sample Metadata Fields
Specimen part, Cell line, Treatment, Time
View Samples- Mus musculus
- 12 Downloadable Samples
Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
DNA Methyltransferase 3A (DNMT3A) is frequently mutated in various hematopoietic malignancies; however, the underlying oncogenic mechanisms remain elusive. Here, we report that DNMT3A mutational hotspot at Arg882 (i.e., DNMT3A-R882H) cooperates with constitutively activated RAS in transforming murine hematopoietic stem/progenitor cells (HSPCs) ex vivo and inducing acute leukemias in vivo. DNMT3A-R882H potentiates aberrant transactivation of stemness gene expression programs, notably transcription factors Meis1, Hox-A, Mn1 and Mycn. Mechanistically, R882-mutated DNMT3A directly binds to cis-regulatory elements of these genes and induces focal CpG hypomethylation reminiscent of what was seen in human leukemias bearing DNMT3A R882 mutation. Furthermore, DNMT3A-R882H induced DNA hypomethylation facilitates gene enhancer/promoter activation and recruitment of Dot1l-associated transcription elongation machineries. Inactivation of Dot1l represses DNMT3AR882H-mediated stem cell gene dysregulation and acute leukemogenicity.
Publication Title
Epigenetic Perturbations by Arg882-Mutated DNMT3A Potentiate Aberrant Stem Cell Gene-Expression Program and Acute Leukemia Development.
Sample Metadata Fields
Specimen part, Time
View Samples- Mus musculus
- 10 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
DNA Methyltransferase 3A (DNMT3A) is frequently mutated in various hematopoietic malignancies; however, the underlying oncogenic mechanisms remain elusive. Here, we report that DNMT3A mutational hotspot at Arg882 (DNMT3A-R882H) cooperates with constitutively activated RAS in transforming murine hematopoietic stem/progenitor cells (HSPCs) ex vivo and inducing acute leukemias in vivo. DNMT3A-R882H potentiates aberrant transactivation of stemness gene expression programs, notably transcription factors Meis1, Hox-A, Mn1 and Mycn. Mechanistically, R882-mutated DNMT3A directly binds to cis-regulatory elements of these genes and induces focal CpG hypomethylation reminiscent of what was seen in human leukemias bearing DNMT3A R882 mutation. Furthermore, DNMT3A-R882H induced DNA hypomethylation facilitates gene enhancer/promoter activation and recruitment of Dot1l-associated transcription elongation machineries. Inactivation of Dot1l represses DNMT3AR882H-mediated stem cell gene dysregulation and acute leukemogenicity.
Publication Title
Epigenetic Perturbations by Arg882-Mutated DNMT3A Potentiate Aberrant Stem Cell Gene-Expression Program and Acute Leukemia Development.
Sample Metadata Fields
Cell line, Treatment
View Samples- Mus musculus
- 4 Downloadable Samples
- Affymetrix Mouse Genome 430 2.0 Array (mouse4302)
Description
PCL family protein Phf19/Pcl3 is one of the accessory components of the PRC2 core complex, and Phf19 is highly expressed in murine ES cells and an ES cell-like embryonic carcinoma cell line, F9 cells.
Publication Title
An H3K36 methylation-engaging Tudor motif of polycomb-like proteins mediates PRC2 complex targeting.
Sample Metadata Fields
Cell line
View Samples- Mus musculus, Homo sapiens
- 13 Downloadable Samples
- Illumina MouseWG-6 v2.0 expression beadchip, Illumina MouseRef-8 v2.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Age, Specimen part, Cell line, Treatment
View Samples- Mus musculus
- 3 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip, Illumina MouseWG-6 v2.0 expression beadchip
Description
We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 9 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Cell line
View Samples- Mus musculus
- 6 Downloadable Samples
- Affymetrix Mouse Gene 2.1 ST Array (mogene21st)
Description
Ezh2 and EZH1 are histone H3 lysine 27 specific methyltransferase. Their hyperactive mutations and overexpression were found in cancer including various hematological malignancies. UNC1999 is a highly selective inhibitor for both enzymes. It suppresses H3K27 tri- and di-methylation globally and inhibits growth of MLL-rearranged acute leukemia cell lines. UNC2400, a di-methylated derivative of UNC1999, is employed an inactive analog compound for assessment of off-target effects. EED knockdown was used to demonstrate gene targets of PRC2.
Publication Title
Selective inhibition of EZH2 and EZH1 enzymatic activity by a small molecule suppresses MLL-rearranged leukemia.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Rattus norvegicus
- 8 Downloadable Samples
- Affymetrix Rat Genome 230 2.0 Array (rat2302)
Description
TNF-a is increased in the synovial fluid of patients with rheumatoid arthritis and osteoarthritis. TNF-a activates MEK/ERK in chondrocytes; however the overall functional relevance of MEK/ERK to TNF-a-regulated gene expression in chondrocytes is unknown. Chondrocytes were treated with TNF-a with or without the MEK1/2 inhibitor U0126 for 24 h. Microarray analysis was used to identify genes regulated by TNF-a in a MEK1/2-dependent fashion.
Publication Title
Egr-1 inhibits the expression of extracellular matrix genes in chondrocytes by TNFalpha-induced MEK/ERK signalling.
Sample Metadata Fields
No sample metadata fields
View Samples