Filters
Technology
Platform
SRP149071
Homo sapiens
16 Downloadable Samples
Illumina HiSeq 2500
Description
Thousands of long non-coding RNAs (lncRNAs) have been identified in the human genome, but specific biological functions and biochemical mechanisms have been discovered for only about a dozen lncRNAs. One specific lncRNA, Non-coding RNA Activated by DNA Damage (NORAD), has recently been shown by genetic deletion to be required for maintaining genomic stability, but its molecular mechanism is unknown. Here, we combine RNA antisense purification (RAP) and quantitative mass spectrometry to identify proteins that directly interact with NORAD in living cells. We show that NORAD interacts with proteins involved in DNA replication and repair in steady-state cells and localizes to the nucleus upon stimulation with replication stress or DNA damage. In particular, NORAD interacts with RBMX (an emerging component of the DNA-damage response) and encodes the strongest RBMX-binding site in the transcriptome. We demonstrate that NORAD controls the ability of RBMX to assemble a ribonucleoprotein complex, which we term NORAD-Activated Ribonucleoprotein Complex 1 (NARC1), containing known suppressors of genomic instability: topoisomerase I (TOP1), ALYREF and the PRPF19/CDC5L complex. Cells depleted of NORAD or RBMX display an increased frequency of chromosome segregation errors, reduced replication-fork velocity and altered cell cycle progression phenotypes that are mechanistically linked to TOP1 and PRPF19/CDC5L function. Expression of NORAD in trans can rescue defects caused by NORAD depletion, but rescue is significantly impaired when the RBMX-binding site in NORAD is deleted. Our results demonstrate that the interaction between NORAD and RBMX is important for NORAD function and that NORAD is required for the assembly of a previously unknown topoisomerase complex (NARC1) that contributes to maintaining genomic stability. Moreover, we uncover a novel function for lncRNAs in modulating the ability of an RNA-binding protein to assemble a higher-order ribonucleoprotein complex. Overall design: We examined gene expression changes and alternative splicing events in wildtype and NORAD depleted cells using RNA sequencing.
Publication Title
The NORAD lncRNA assembles a topoisomerase complex critical for genome stability.
Sample Metadata Fields
Cell line, Subject, Time
View Samples- Homo sapiens
- 17 Downloadable Samples
Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Temporal changes of the expression levels of the complete human transcriptome during the first 24 hours following infection of IFN-pre-treated macrophages. This approach has allowed us to identify genes involved in the IFN signaling that have an impact on HIV-1 infection of macrophages
Publication Title
TRAF6 and IRF7 control HIV replication in macrophages.
Sample Metadata Fields
Specimen part, Time
View Samples- Homo sapiens
- 10 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
INTRODUCTION:
Publication Title
Increased placental expression and maternal serum levels of apoptosis-inducing TRAIL in recurrent miscarriage.
Sample Metadata Fields
Specimen part
View Samples- Mus musculus, Homo sapiens
- 13 Downloadable Samples
- Illumina MouseWG-6 v2.0 expression beadchip, Illumina MouseRef-8 v2.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Age, Specimen part, Cell line, Treatment
View Samples- Mus musculus
- 3 Downloadable Samples
Illumina MouseRef-8 v2.0 expression beadchip, Illumina MouseWG-6 v2.0 expression beadchip
Description
We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 9 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Cell line
View Samples- Homo sapiens
- 191 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Normal children, children with SIRS, children with sepsis, and children with septic shock.
Publication Title
Genomic expression profiling across the pediatric systemic inflammatory response syndrome, sepsis, and septic shock spectrum.
Sample Metadata Fields
No sample metadata fields
View Samples- Homo sapiens
- 16 Downloadable Samples
- Affymetrix Human Genome U133 Plus 2.0 Array (hgu133plus2)
Description
Rationale: We previously generated genome-wide expression data in children with septic shock, based on whole blood-derive RNA, having the potential to lead the field into novel areas of investigation.
Publication Title
Validating the genomic signature of pediatric septic shock.
Sample Metadata Fields
Sex
View Samples- Homo sapiens
- 24 Downloadable Samples
- Illumina HiSeq 2000
Description
By 2 weeks after stem cell transplantation, there was differentiated changes in T cell phenotype between autograft and allograft. RNA-seq was used to reveal the different transcription profiles of these T cells at week 2 after SCT. Overall design: Compare the transcription profile of the T cells in allograft and autograft transplantation patients.
Publication Title
Unique features and clinical importance of acute alloreactive immune responses.
Sample Metadata Fields
Specimen part, Disease, Subject, Time
View Samples- Mus musculus
- 8 Downloadable Samples
- Illumina HiSeq 2500
Description
We used a mouse expressing three alleles 1) KitV558Delta/+ activating allele that develop GIST-like tumors in the cecum, 2) Etv1 flox/flox conditional knockout allele and 3) Rosa26-CreERT2 tamoxifen activated Cre allele. Mice were treated with either Tamoxifen (to delete Etv1) or corn oil (control). Cecal tumors were isolated for gene expression profiling by RNA-Seq. Overall design: Expression profile mouse cecal GIST tumor with or without Etv1 ablation was generated by RNA-Seq
Publication Title
Combined inhibition of MAP kinase and KIT signaling synergistically destabilizes ETV1 and suppresses GIST tumor growth.
Sample Metadata Fields
No sample metadata fields
View Samples