Filters
Technology
Platform
Homo sapiens
24 Downloadable Samples
Illumina human-6 v2.0 expression beadchip
Description
The new official nomenclature subdivides human monocytes into three subsets, classical (CD14++CD16-), intermediate (CD14++CD16+) and nonclassical (CD14+CD16+). Here, we comprehensively define relationships and unique characteristics of the three human monocyte subsets using microarray and flow cytometry analysis. Our analysis revealed that the intermediate and nonclassical monocyte subsets were most closely related. For the intermediate subset, majority of genes and surface markers were expressed at an intermediary level between the classical and nonclassical subset. There features therefore indicate a close and direct lineage relationship between the intermediate and nonclassical subset. From gene expression profiles, we define unique characteristics for each monocyte subset. Classical monocytes were functionally versatile, due to the expression of a wide range of sensing receptors and several members of the AP-1 transcription factor family. The intermediate subset was distinguished by high expression of MHC class II associated genes. The nonclassical subset were most highly differentiated and defined by genes involved in cytoskeleton rearrangement that explains their highly motile patrolling behavior in vivo. Additionally, we identify unique surface markers, CLEC4D, IL-13RA1 for classical, GFRA2, CLEC10A for intermediate and GPR44 for nonclassical. Our study hence defines the fundamental features of monocyte subsets necessary for future research on monocyte heterogeneity.
Publication Title
Gene expression profiling reveals the defining features of the classical, intermediate, and nonclassical human monocyte subsets.
Sample Metadata Fields
Specimen part, Subject
View Samples- Homo sapiens
- 12 Downloadable Samples
Illumina HiSeq 2000
Description
COP1 regulates MAP kinase dependent stability Pea3 transcription factors. We determined the role of COP1 in the regulation of MAP kianse transciptional output. We transfected GIST882 cells with siRNA against a scrambled sequence and two sequences against COP1. We treated cells for 8 hours with vehicle or 100 nM PD0325901 in duplicate and isolated RNA for sequencing. Overall design: Examination of transcriptome in COP1 intact and COP1 loss GIST882 GIST cells in response to MAP kinase inhibition.
Publication Title
COP1/DET1/ETS axis regulates ERK transcriptome and sensitivity to MAPK inhibitors.
Sample Metadata Fields
Cell line, Treatment, Subject
View Samples- Homo sapiens
- 6 Downloadable Samples
- Illumina HiSeq 2000
Description
ETV1 is amplified in a subset of melanomas. Here, we performed RNA-seq on two BRAF V600E mutant melonoma cell lines transduced with a scrambed shRNA and two individual ETV1 shRNA Overall design: Two melanoma cell lines (A375 and Colo800) were infected in duplicate with three shRNA viruses (Scrambled, ETV1sh1-B11TRCN0000013923, ETV1sh2-TRCN0000013925). Four days after infection, RNA was harvested for expression profiling.
Publication Title
COP1/DET1/ETS axis regulates ERK transcriptome and sensitivity to MAPK inhibitors.
Sample Metadata Fields
Cell line, Treatment, Subject
View Samples- Mus musculus, Homo sapiens
- 13 Downloadable Samples
- Illumina MouseWG-6 v2.0 expression beadchip, Illumina MouseRef-8 v2.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Age, Specimen part, Cell line, Treatment
View Samples- Homo sapiens
- 18 Downloadable Samples
- Illumina HumanHT-12 V3.0 expression beadchip
Description
This SuperSeries is composed of the SubSeries listed below.
Publication Title
ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Mus musculus
- 3 Downloadable Samples
Illumina MouseRef-8 v2.0 expression beadchip, Illumina MouseWG-6 v2.0 expression beadchip
Description
We performed expression mouse profiling of prostates of 3 month WT, ERG, PTEN f/f and Pten f/f;ERG mice.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Specimen part
View Samples- Homo sapiens
- 12 Downloadable Samples
- Illumina HumanHT-12 V3.0 expression beadchip
Description
ETV1 is highly expressed in GIST cells and required for their survival and growth. To identify genes and pathways regulated by ETV1 in GIST, we performed expression profiles of GIST cells after ETV1 knockdown.
Publication Title
ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.
Sample Metadata Fields
Specimen part, Cell line
View Samples- Homo sapiens
- 9 Downloadable Samples
- Illumina MouseRef-8 v2.0 expression beadchip
Description
Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
Publication Title
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss.
Sample Metadata Fields
Cell line
View Samples
GSE22433- Homo sapiens
- 6 Downloadable Samples
- Illumina HumanHT-12 V3.0 expression beadchip
Description
Gastrointestinal Stromal Tumor frequently harbor mutations in the KIT receptor tyrosine kinase and depend on its activity for growth. This underlies the efficacy of imatinib, a inhibitor of KIT activity, in GIST management. GIST882 is a patient derived GIST cell line that harbor a K640E exon 13 KIT mutation and is sensitive to imatinib treatment. To analyze the downstream effect of KIT inhibition, GIST882 cells were treated for 8 hours with 1M Imatinib.
Publication Title
ETV1 is a lineage survival factor that cooperates with KIT in gastrointestinal stromal tumours.
Sample Metadata Fields
Cell line
View Samples- Homo sapiens
- 6 Downloadable Samples
- Illumina HiSeq 2000
Description
To determine genes regulated by HNF1A in 22Rv1, we performed siRNA mediated knockdown of HNF1A using pooled siHNF1A (L-008215-00-0005 5 nmol) and pooled siSCR purchased from Dharmacon. RNA was harvested 3 days after transfection and gene expression profiling was performed. Similarly to determine genes regulated by HNF1A in LNCaP, we performed retroviral transduction of LNCaP cells in duplicate for HNF1A and empty vector control expression. cDNA for HNF1A in RC211201 vector (origene) was subcloned into a murine stem cell virus (MSCV)-based retroviral vector with hygromycin selection marker (Addgene). After 3 days of transduction, cells were selected for four days in hygromycin and later on RNA was harvested for gene expression profiling. Overall design: RNA profiles were generated by deep sequencing using Illumina HiSeq.
Publication Title
Aberrant Activation of a Gastrointestinal Transcriptional Circuit in Prostate Cancer Mediates Castration Resistance.
Sample Metadata Fields
Cell line, Subject
View Samples